Loading...
 

Release Notices Help

Forums > Release Notices> Novoalign V2.05.32

Novoalign V2.05.32

This is a correction to V2.05.31.

Novoalign

  1. In 2.05.31, the correction for 'Seg Fault' error was to lower alignment threshold when reads had adapter trimmed from them. This change also had unintended effect of reducing threshold even when the read wasn't trimmed and reducing the number of alignments found. This has been corrected.
  2. Change to default adapter sequence for paired end adapter trimming. The read1 default adapter sequence is now "AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG". The change will have no effect as Novoalign only uses the first 12 bp and these haven't changed. Prefer refer to our Wiki for a description of paired end adapter trimming.

Show posts:
 
Show HelpHelp