Jump to Content

Release Notices

Forums > Release Notices> Novoalign V2.05.32

[ prev topic ]

Novoalign V2.05.32

Posted by colin on Tue 30 of Mar., 2010 13:45 MYT

This is a correction to V2.05.31.

Novoalign

In 2.05.31, the correction for 'Seg Fault' error was to lower alignment threshold when reads had adapter trimmed from them. This change also had unintended effect of reducing threshold even when the read wasn't trimmed and reducing the number of alignments found. This has been corrected.
Change to default adapter sequence for paired end adapter trimming. The read1 default adapter sequence is now "AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG". The change will have no effect as Novoalign only uses the first 12 bp and these haven't changed. Prefer refer to our Wiki for a description of paired end adapter trimming.

Reads: 6861

Search Help

Non Advanced Search or Natural Search

The documents are returned sorted on relevance depending on order, proximity, frequency of terms.

Advanced Search or Boolean Search

Default search behavior

By default, all search terms are optional. It behaves like an OR logic. Objects that contain the more terms are rated higher in the results and will appear first in their type. For example, wiki forum will find:

objects that include both terms
objects that include the term wiki
objects that include the term forum

Requiring terms

Add a plus sign ( + ) before a term to indicate that the term must appear in results. Example: +wiki forum will find objects containing at least wiki. Objects with both terms and many occurences of the terms will appear first.

Excluding terms

Add a minus sign ( - ) before a term to indicate that the term must not appear in the results. To reduce a term's value without completely excluding it, use a tilde. Example: -wiki forum will find objects that do not contain wiki but contain forum

Grouping terms

Use parenthesis ( ) to group terms into subexpressions. Example: +wiki +(forum blog) will find objects that contain wiki and forum or that contain wiki and blog in any order.

Finding phrases

Use double quotes ( " " ) around a phrase to find terms in the exact order, exactly as typed. Example: "Alex Bell" will not find Bell Alex or Alex G. Bell.

Using wildcards

Add an asterisk ( * ) after a term to find objects that include the root word. For example, run* will find:

objects that include the term run
objects that include the term runner
objects that include the term running

Reducing a term's value

Add a tilde ( ~ ) before a term to reduce its value indicate to the ranking of the results. Objects that contain the term will appear lower than other objects (unlike the minus sign which will completely exclude a term). Example: +wiki ~forum will rate an object with only wiki higher that an object with wiki and forum.

Changing relevance value

Add a less than ( < ) or greater than ( > ) sign before a term to change the term's contribution to the overall relevance value assigned to a object. Example: +wiki +(>forum < blog) will find objects that contain wiki and forum or wiki and blog in any order. wiki forum will be rated higher.

Show Help